BICD 123 Spring 2007 Yanofsky Identification of mutations in the APETALA3 gene of Arabidopsis Introduction In today s experiment we will begin a molecular experiment that will allow us to sequence the AP3 gene from the ap3 mutant and compare its DNA sequence to the wild type AP3 gene The approach is quite simple You will begin by isolating genomic DNA from the ap3 mutant and then you will PCR amplify the AP3 gene The resulting amplified PCR product will be cloned and sequenced As a control you will perform the same procedures using wild type plants After the DNA sequencing is completed you will use the computer to compare your mutant and wildtype sequences to determine if your mutant carries a mutation in the AP3 gene Simple right Polymerase Chain Reaction The polymerase chain reaction PCR permits the amplification of a single template molecule through the use of two oligonucleotide primers that flank a small segment of DNA PCR involves heat denaturation of the DNA to separate the two strands hybridization of the primers and extension of the primers with a heat stable DNA polymerase Thermus aquaticus Taq polymerase The cycle is repeated 30 40 times resulting in exponential amplification of the target DNA molecule This technique is extremely sensitive For instance a single virus molecule in a background of 105 mammalian cells can be amplified yielding nanogram quantities of the amplified sequence Day 1 1 Prepare genomic DNA from one ap3 mutant and one wild type plant 2 Set up PCR reactions using the two AP3 specific oligonucleotide primers Day 2 1 Size fractionate PCR products on an agarose gel to determine the size of the amplified product and to confirm that the reactions were successful 2 Ligate PCR products to plasmid vector 3 Transform E coli Day 2 5 Inoculate liquid cultures with E coli transformants three ap3 mutant and three wild type Day 3 Purify miniprep plasmid DNA from liquid cultures Do restriction enzyme digests and size fractionate on agarose gels Prepare successful clones for sending to the sequencing center Send one ap3 mutant and one wild type clone for sequencing Day 4 Computer analysis of DNA sequences Comparison of your sequences to the wild type AP3 gene will allow you to identify possible molecular changes in the mutant Experimental Plan Day 1 DNA extraction Extract DNA from one ap3 mutant and one wild type plant 1 Snip one healthy leaf from each plant and place into the bottom of a 1 5 ml microfuge tube Wear gloves to avoid contamination during handling Macerate the tissue using a disposable grinder at room temperature for 15 seconds without buffer 2 Add 400 l of extraction buffer and vortex the sample for 5 seconds You can leave this sample at room temperature Extract the DNA from the your other sample 3 Centrifuge the extracts for 1 minute at 13 000 rpm full speed in the microfuge 4 Remove 300 l of the supernatant liquid and transfer it to a fresh microfuge tube Add 300 l of isopropanol vortex briefly and leave at room temperature for 2 5 min 5 Centrifuge again at 13 000 rpm for 5 min in the microfuge Carefully remove the supernatent liquid leaving the pellet in the bottom of the tube Allow pellet to air dry 15 20 minutes at room temp inverted on a Kimwipe paper towel Make sure it is dry 6 Resuspend the pellet in 70 l sterile water sufficient for a 50 l PCR reaction 2 5 l of this sample is PCR reactions Primers Primer AP3 A 5 CAAAGAGAGAAGAATATGGCG 3 Primer AP3 B 5 GCTCATGTATGAGATTCTTTTG 3 Set up your PCR reactions for one ap3 mutant and one wild type DNAs Also set up one PCR reaction that does not contain any added plant DNA 3 total Methods All of the following steps have to be done on ice 1 Make a PCR Master Mix Reagents H2O 10X Buffer with Mg2 AP3 A primer AP3 B pimer dNTPs Enzyme Taq Polymerase Total 1 in 1 5 ml Tube 1 reaction l 33 5 5 0 1 0 1 0 4 0 0 5 Master Mix 4X l 134 0 20 0 4 0 4 0 16 0 2 0 45 0 180 0 2 Aliquot 45 l of Master Mix into 3 PCR tubes 2 3 Label each tube i e WT ap3 No DNA and add your lab group number 4 Vortex DNA and add 5 l of the appropriate DNA sample into each individual tube to make a final volume of 50 l Add 5 l H2O to the no DNA control 5 Put the tubes in PCR machine and set the PCR condition Because the only difference between each reaction is the DNA sample we can make the mix that contains everything except DNA first 2 Use special thin wall tube for doing PCR 1 3 PCR conditions Steps Initial Denaturation Denaturation Annealing Extension Final Extension Hold Temperature 94 94 52 72 72 4 Time min 5 0 5 0 5 2 0 5 overnight Repeat 35 times After the PCR reactions are done the TAs will store the samples in the fridge You will analyze the samples in the next lab class Solution DNA extraction buffer Tris HCl pH 7 5 NaCl EDTA SDS 200 mM 250 mM 25 mM 0 5 Reference Saiki R K et al 1988 Primer directed enzymatic amplification of DNA with a thermostable DNA polymerase Science 239 487 491 4 Day 2 Overview To assay for the presence of amplified sequences in your PCR reactions run a 0 8 agarose gel in TBE buffer containing 5 l SyberSafe For each lane of your gel take 10 l of PCR mix add 4 l of 6X loading buffer dye and load into the well You should also run a DNA molecular weight ladder on your gel Run the gel at 120 V for about 1 hour Photograph your gel using the camera and the UV transilluminator You should see a PCR product for all of your samples except for the no DNA control What size is the product Can you see any size difference between wild type and mutant samples What does this tell you about the molecular nature of the mutant alleles How will you confirm your hypothesis 1 Size fractionation of PCR generated DNAs on agarose gel For day 2 only DNA from each PCR reaction must be size fractionated on an agarose gel and photographed Remember to load a molecular weight size marker the 1 kb ladder on the same agarose gel 1 In a 250 ml flask add 0 8 grams of agarose to 100 ml of 1X TBE agarose gel buffer 2 Microwave for approximately 2 3 minutes or until agarose is completely in solution Swirl flask and observe that all agarose is in solution note to save time steps one and two will be done in advance 3 Carefully add 5 l SyberSafe solution to melted agarose 4 Allow agarose to cool for about 10 minutes by placing in 50 oC water bath and pour into gel tray with inserted comb Make sure gel tray is …
View Full Document
Unlocking...