Human Migration CS374 Fall 2006 Lecture 11, 10/24/06 Lecturer: Anjalee Sujanani Scribe: Ashutosh Saxena Human Migration Based on the following papers: 1. Review: The application of molecular genetic approaches to the study of human evolu-tion. L. Luca Cavalli-Sforza & Marcus W. Feldman, Nature Genetics 33, 266 - 275 (2003) 2. Recovering the geographic origin of early modern humans by realistic and spatially ex-plicit simulations. Nicolas Ray, Mathias Currat, Pierre Berthier, and Laurent Excoffier, Genome Res., Aug 2005; 15: 1161 - 1167. 3. Support from the relationship of genetic and geographic distance in human populations for a serial founder effect originating in Africa. Sohini Ramachandran, Omkar Deshpande, Charles C. Roseman, Noah A. Rosenberg, Marcus W. Feldman, and L. Luca Cavalli-Sforza, PNAS, November 1, 2005, Vol. 102, No. 44 Additional references: 4. Did Early Humans Go North or South? Peter Forster and Shuichi Matsumura, Science, vol. 308, 2005. 5. Tracing Modern Human Origins, Harpending et al. and Vincent Macaulay et al., Letters to Science, vol. 309, 2005. 1. Introduction This lecture describes recent research on Human Migration by analyzing DNA of living humans collected from different locations. They studied genetic variation in DNA from samples collected from humans at different places. Recent genetics and archeological studies suggested that the modern humans had a unique origin in Africa. The papers discussed in the paper made studies on quantifying the likelihood of this model, com-pared to alternative hypotheses of human evolution. They considered various models and calculated the likelihood of each model through simulations. Considering a world-wide set of geographic locations as possible sources of the human expansion, they found that variations in the genetic data of the globally distributed populations are best explained by an expansion originating in Africa, and that no geographic origin outside of Africa can explain the observed patterns of genetic diversity as well.Human Migration CS374 Fall 2006 Lecture 11, 10/24/06 Lecturer: Anjalee Sujanani Scribe: Ashutosh Saxena 2. Background We give a short historical development of DNA sequencing, motivating Human Migra-tion: 1919: Existence of human genetic variation was first demonstrated in a study of ABO gene. 1966: Studies showed that almost every protein has genetic variants. These variants became useful markers for population studies. 1980: A new method to construct a genetic linkage map of the human genome by using radioisotopes generated more new markers. 1986: Polymerase Chain Reaction (PCR) was developed. This allowed a small amount of the DNA molecule to be amplified exponentially. This ex-panded the number of studies that could work directly with DNA. 1990: Development of automated DNA sequencing. Genetic Variation is used to study the following aspects of human evolution: genome structure and population history; and the following aspects of human migration: dating origin of our species, tracking migrations of our species using DNA; and to also study the relationship of separated human populations. All genetic variation, which is an important factor in studying human migration, is caused by mutations; the most common factor is called Single Nucleotide Polymor-http://www.ncbi.nlm.nih.gov/Class/NAWBIS/Modules/Variation/var17.htmlHuman Migration CS374 Fall 2006 Lecture 11, 10/24/06 Lecturer: Anjalee Sujanani Scribe: Ashutosh Saxena phism (SNP). A single base change, occurring in a population at a frequency of >1% is termed a SNP. When a single base change occurs at <1% it is considered to be a muta-tion. A marker is a gene or other segment of DNA whose position on a chromosome is known. As mentioned, SNPs are DNA sequence variation occurring when a single nu-cleotide - A, T, C, or G - in the genome (or other shared sequence) differs between members of a species. E.g., for sequences: AAGCCTA and AAGCTTA; we would say that there are two alleles: C and T. STR is a common class of polymorphism, con-sisting of a pattern of two or more nucleotides repeating in tandem, with a repeat unit of 2-10 base pairs, e.g. GATAGATAGATAGATAGATAGATA Some more definitions: Allelic frequency defines the variation at a single nucleotide po-sition. Polymorphism is the variation in DNA sequences between individuals. Natural Selection is the tendency of beneficial alleles to become more common over time and detrimental ones to become less common. Random Genetic Drift is the fundamental ten-dency of any allele to vary randomly in frequency over time due to statistical variation alone. Note that both Natural selection and Random Genetic Drift can lead to elimina-tion or fixation of an allele. 3. Research presented on the papers For large populations that are geographically and genetically distant, history can be in-ferred by population trees, if it is assumed that the fissions occur randomly in time and that there is a constant rate of neutral evolution in each population between the fissions. For neutral evolution, where many changes that occur during evolution are selectively neutral, the frequency of a selectively neutral gene is as likely to decrease as it is to in-crease by genetic drift. Further, on an average the frequencies of neutral alleles remain unchanged from one generation to the next. In case of migration, if there is an average of 1 immigrant per generation in a popula-tion, then it is sufficient to keep drift partially in check and avoids complete fixation of the alleles. On the other hand, if the whole population migrates and settles elsewhere, and if it is initially small and then expands, then there is change in the founder fre-quency vs. original population frequency; and a much larger change in founder fre-quency vs. new location population frequency. In this case, there are more chances for a drift to occur, and it causes divergence and intergroup variations in the allele frequen-cies. Therefore, group migration has opposite effect to individual migration. A summary tree for world populations is shown in the figure below, for a polymor-phism of 120 protein genes, and for 1,915 populations. A high resolution population history with mtDNA
View Full Document
Unlocking...